No Style :: No Content

Iceland update

Got in from Dubai last night after almost 20 hours of travel (7+ hour layover in Istanbul). The plane left Dubai at 4:30 am, so there was no point trying to sleep. Caught a nap in the Istanbul lounge but was still pretty keyed up and had a ton of work to do anyway - throughout all this I'm still juggling four or five big projects that are all due this month.

Anyway, caught some sleep last night, now am off to CPH again, heading for Reykjavik to give another presentation. My first time in Iceland. Really looking forward to it, but it feels someone's been slapping me around for about a week. My body doesn't know where it is any more. And going from swimming in the Persian Gulf yesterday morning and getting a nice tan, to the blizzard that I'm sure is waiting for me in Iceland, is all going to do wonders to my immune system. But no complaints.

They tell me I shouldn't leave Iceland till I've taken a dip in the "blue lagoon," which is some kind of volcanic vent filled with hot mineral water. It should be restorative, so they say- fox knows I can use a little of that!

Update

Quick update while I'm waiting to get tired enough to sleep.

Istanbul seems to have been a success. Still waiting on final feedback but the initial feedback is good. The meeting with the IT press went off pretty well, I was actually thinking during the interview that when I was a journalist, I never let my subjects off the hook so easily.

The city was good but I was so mentally fried after the company business was over that I wasn't ready for dealing with a huge city. People are super friendly, but like Russia it's a real sink-or-swim hustle culture. You have to spend a lot of energy just doing the usual things, if you want to avoid having people take advantage of you. It's a crazy big city with a lot of frenetic energy, in all the good ways and the bad ways which that implies.

Dubai has been something else altogether. It's the most surreal place I've ever seen, including San Francisco. And it's grown from a tiny mud-hut trading hamlet to the most luxurious and super-modern city I've ever seen, literally right out of the desert in just the last 50 years. I would not have believed this place if I hadn't been looking at it with my own eyes all day.

First impression- walking off the Singapore Airlines 777-300 and seeing a huge poster in the DXB concourse that listed a special offer for buying an apartment in a new series of residential buildings now under construction. Buy an apartment and get a free Jaguar luxury sedan. And then all the buyers are entered in a raffle. First prize? A six-seat private jet plane.

(Side note- all the stories I've heard about Singapore Airlines appear to be true. They do have the best service, best food and cutest flight attendants I've encountered yet.)

I didn't have time to make this a working trip - I'd have loved to score some interviews while I was here and write a story about the politics & economy - but I couldn't spare the time or mental energy. I've still learned a hell of a lot in just the last 36 hours though. Enough to infuriate me further over how ignorant and naiive I've been about the world. And continue to be despite best efforts.

Started off today with a tour of the Jumeira Mosque as part of an "open doors, open minds" initiative started by Sheikh Mohammed to foster better understanding between expats and Islam & Emirati culture. The most important part was a long Q&A between the attendees and Mohammed, not the Sheikh but one of the students of the mosque, where Mohammed spent 45 minutes answering some pretty tough questions. I had a lot of questions of my own but I shut up and watched the exchange because I thought the questions the crowd was asking said as much about Western perceptions of Islam as Mohammed's answers said about the religion itself. I'm really glad I went.

Next was a tour of the Sheikh Sayeed al-Maktoum house, which had exhibits of photographs and artifacts from the history of Dubai and the UAE. The photos from the 1950s are unbelievable- a creekside village of mud and palm frond huts with a few sandstone military buildings was all there was then. Today it looks like Berlin did in the 1990s after the wall fell- a forest of cranes and steadily rising architecture. (It's even more intense in Dubai than Berlin because here shifts of construction workers go at it 24-hours a day.)

Then I spent the afternoon walking around the spice soukh and gold soukh in Deira, on the east side of the "creek." Just walking around among the people, smelling and tasting spices I'd never experienced before, haggling with merchants and feeling lucky to be alive. In one spice shop (not really a shop since the spice merchants work in open ended enclaves that face the internal covered walking streets), I saw an open canvas bag of Japanese takasago treats, so I said "Ah, takasago!" The shopkeeper then demanded that I teach him all the Japanese words I know (which mostly came from reading "Shogun" and whatever pathetic Japanese I picked up in San Francisco while fruitlessly trying to pick up the sushi girls there). He wrote the words and translations carefully into a pad, in a language that looked like Tamil or some Indian dialect, and then in exchange for the favor he gave me a break of five Dirhams (20-percent) off the price of the spices I wanted.

After the soukhs I met my hosts at a marina-front mall/hotel/restaurant complex near their apartment and we ate & shopped more till everything started closing around 11pm. Tomorrow morning I plan to take a swim in the Persian Gulf and then go out into the desert with a company that leases 4WD vehicles for half-day excursions - dune jumping with the 4WDs & then eating a bedouin dinner at sunset surrounded by nothing but desert and sky. Apparently, a lot of people who see Dubai for the first time don't want to leave, and make plans to come back permanently. This doesn't suprise me at all.

Lots more, and loads of pictures. But need to try to sleep now, Insh'allah.

Update

Just got back to the hotel from dinner with my Turkish colleague at a fish restaurant right at the edge of the Bosphorus- gorgeous view of the bridge, and the Asian side of the city just across the water less then a kilometer away. I hadn't realized the Bosphorus was so narrow.

My colleague ordered for us- calamari, anchovy and dolma "meze" appetizers, a whole blue-fish complete with head, skin charred black from the grill, and lots of spicy anise-flavored raki. The raki turns milky white when you add water to thin it, and you should only add ice after the water goes in. The ice would kill the taste if you add it straight to the raki.

First impressions of Istanbul- flying in along a left-base pattern to Ataturk international, crossing the old city and the Bosphorus before turning back towards the airport. Seeing the Topkapi Palace and the domes and six minarets of the Aya Sophia from the air, lit up like a fairytale. The taxi from the airport into the city, jinking through crazy traffic on the freeway in, past the ruins of walls built before the fall of the Byzantine empire. Different music. Different body language.

Unreasonably friendly people so far, in a city bigger than New York. There's a whole world out here, and I am still so naiive.

Pressure!

Just found out the largest IT magazine in Turkey wants to interview me in Istanbul on Thursday.

No pressure.

Empty seat on the Alpha Line

Just found out that the day after I arrive back from Istanbul & Dubai, I need to get on another plane for Iceland. Then, just perhaps, I may need to go straight from Reykjavik to Seattle for a few days, though I'm strongly resisting the need for that last leg. San Diego and New York in March, Chicago in April. No rest for the wicked.

The worst part is I won't have a lot of time to practice between the Istanbul & Iceland gigs, so I need to memorize two speeches at once. My brain is so fried from lack of sleep lately that I'm feeling a bit daunted by the prospect, considering everything else I have to do between now and then. But I've been here before, times that feel like you're falling off a cliff. The only way through is to use the same mindset as when you're skydiving- let yourself fall out into nothing with absolute trust in your equipment and training--everything that brought you to that point, rather than trying to hold to uncertain faith in the outcome.

When this is over, assuming I succeed, I'm going to look back on it and say it was the best of times.

Never Let Me Go

I was a quarter of the way into Imperial Life in the Emerald City, a half first-person, half journalistic account of the author's time spent in the Green Zone in Baghdad. It's a good book & well written, but after reading Rise of the Vulcans, Fiasco and State of Denial in the last few months I feel like I'm suffering from Baghdad-burnout.

I switched to Never Let Me Go, by Kazuo Ishiguro and am already three quarters way through it. Brilliant book, gently surreal the way intensely visual dreams are. I won't spoil it by going into the plot, but the way Ishiguro slowly reveals layers of background behind the shared secrets of the characters' lives is really masterful.

I don't want to seem insensitive by grouping Ishiguro together with the only other Japanese author whose stories I've read obsessively, but the surreal-yet-mundane plotline and simple descriptive style remind me a lot of Haruki Murakami.

We all need a little fiction in our lives, days like these.

Speed Control

Just for the record, I have not seen this latest traffic control scheme by the Danish Road Safety Council in action (but I don't get out that much these days.) I actually found out about it from a colleague of mine in Paris, who was asking me about it and bitching about the lack of creativity of the French traffic cops.

I'm still not convinced that this isn't some kind of pisstake. If it's a guerilla marketing campaign though, they've done it very subtly because I'm not seeing what product they could be hawking (unless it's the Danish tourism bureau that's behind it all).

But I suppose it could be real. The Danes are practical by nature, and refreshingly free of moralistic hangups compared to most of middle America (thank fox). I wouldn't put it past them.

Here's the site with the newscast my French friend sent me - the report named, somewhat dubiously, "Spotlight on the world." Speed Bandits

TACG

I just remembered a vivid dream I had just before I woke up this morning. I'd been in a large octagonal room that had been converted into a library with shelves that stretched up to the four-meter cieling. the room was painted white with old raw oak fittings, and a skylight above. The shelves were filled with books, bound in dark blue bindings at the top shelves, and each shelf below held books of a lighter color blue, until the books on the lowest shelf at knee height were a light cyan. The floor was strewn with white loose paper volumes that were strung together with pieces of twine.

There was another man in the room, a friend of mine who I knew was a scientist. He explained that the books were all scientific journals dating back to the 19th century. The oldest books were at the top, and the newest volumes were the papers on the floor from this year, which had not yet been bound because they had just been submitted and accepted. I picked a thick stack of paper off the floor and opened it, careful not to break the twine that was holding it together through hole punches on the paper's left side.

The first article I read was a documentation of the evolution of DNA, proving that DNA had evolved slowly through natural processes more than a billion years ago. I didn't understand everything I read but knew that it was true, and was sorry that there were still too many people on the planet that wouldn't believe the proof of the article. One page showed a diagram of how different chemicals arranged themselves until the building blocks of DNA formed and began reproducing identical strings of molecules. The letters TACGTACGTACGTACGTACGTACG repeated across the bottom of the page.

I began reciting the names of the four compounds that make the TACG arrays that compose all DNA, surprised that I could still remember the names so long after I'd learned them in school. Thymine, Adenine, Cytosine, Guanosine... As I began reciting, my scientist friend spoke the names with me, as if a mantra. "Thymine, Adenine, Cytosine, Guanosine..."

The story goes that when Francis & Crick discovered DNA and built the first model of its delicate double-helix structure, one of them, I forget which one, said to the other, "I knew it would be beautiful."

I had the crap kicked out of me at work today, really difficult day, and I'd forgotten all about the dream. But then on BBC just now they announced that scientists had gotten the initial analysis of the chemicals inside a large meteorite that fell to earth in Canada a couple of years ago. The meteorite was older than the planet Earth itself, and had been wandering the solar system for billions of years. But when they got the results, the scientists found clear traces of amino acids inside.

Amino acids are the building blocks of proteins, and proteins are the building blocks of life. So the dream came back. Strong, like a deja vu.

Enough already!

I swear to fuck, the next time somebody says "It's like we're between Iraq and a hard place, huh huh..." I'm going to have some kind of brain spasm.

It was funny like the first 600 times I heard it, but knock it off already!

That is all.

Amazon price guarantee

My last post for the day is kind of a public service notice. I heard on a Slate podcast a couple of days ago that Amazon has a secret price guarantee. They don't mention it anywhere, apparently, but it exists. So if you buy something from Amazon (a Christmas gift, for example), and the price goes down on the Amazon website within the next 30 days (because of an after-Christmas sale, for example), you can dial the Amazon customer service number (which is also secret) and ask for a refund. You don't get it if you don't ask.

The number is 1-800-201-7575. To get a human right away, dial extension 7.

Just doing my annual good deed for humanity here. Love you too.

Speaker Pelosi

One of the best New Year's gifts I could have gotten was the fact that Nancy Pelosi, the Congresswoman representing my own district (San Francisco was my last address in the US so I'm still registered as an absentee voter from there) is now the first female Speaker of the House in the history of the country. I'm really happy, not only because I agree with most of her politics but it's about time we had a broader representation in this country than just white men. It's great that we have a woman speaker. Next maybe a woman president?

It's possible if the Democrats don't screw up over the next two years. It's going to be a treacherous road to walk though, that's certain...

2007 Podcasts

For those lucky souls out there who got iPods for Christmas, I give you the list of podcasts to which I subscribe. Good stuff for the commute to work, shopping, cooking, etc. Not sure if this is interesting to, like, anybody out there, but I humbly accept your adoration and love mail anyway.

You can subscribe to all of these in iTunes. Just click Podcasts in the left playlist & resource window, then click the podcast directory button in the lower right. You can search by name or topic, click Subscribe, and you're done.

Culture & Music

• Alan Watts podcast Insight into non-Western religion.


• Dark Horizons Industrial music from my old radio station.


• Dave's Lounge Consistently good weekly chillout podcast. I've found a lot of good music courtesy of Dave.


• Slate Magazine Daily Podcasts Special mention for this one- from news, culture, politics & entertainment, this is one of the best and most interesting podcasts out there.


• The Chillcast with Anji Bee More good chillout music. She's got a voice that can melt titanium.


• Tiki Bar TV (video) Forbidden cocktails in a swank pad. Let Doctor Tiki write you a prescription.

News

• Alive in Baghdad (video) Independent journalism from Baghdad by Iraqis, not the networks or the government.


• Amanda Congdon on ABC News (video) "New media" journalism. Congdon was one of the first generation of video bloggers before she got picked up by ABC.


• Business Week Behind this week's cover stories


• Democracy Now! In depth reporting from the left side of the dial. News you won't hear on the mainstream networks.


• NPR Podcast Directory Lots of podcasts from NPR here. Check out Foreign Dispatch and the World Story of the Day.


• Slashdot Review Ten minutes of hardcore tech news culled from Slashdot.


• Stratfor Daily Podcast Daily briefing from the civilian intelligence service Strategic Forecasting.


• The Changing World International stories from BBC and Public Radio International


• The Economist Weekly podcast from the Economist magazine.

Politics & Analysis

• This Week with George Stephanopoulos Besides Josh Lyman from West Wing, he's been my other role model. People say we kinda look alike.


• Macroeconomic Analysis A recording of a complete semester of lectures from UC Berkeley. More classes are available here.


• Face the Nation Political talk show with Bob Schieffer.


• On the Media Media analysis from WNYC.


• Meet the Press Political talk show with Tim Russert. This is probably the most influential talking head show of them all.


• News Hour with Jim Lehrer Analysis of current events. Also check out the Newsmaker interviews, the analysis with Shields & Brooks and the Supreme Court Watch podcast.


• NOW on the News Culture & politics interviews.


• New York Times podcasts. Check out the weekly Op-ed and the Times World View.


• The McLaughlin Group The famous panel program chaired by the loud but lovable John McLaughlin.


• Barack Obama podcast Obama speaks his mind.


• Washington Week PBS panel program hosted by Gwen Ifill.

Warren Ellis on Second Life

I joined Second Life a few weeks ago, and quickly found that my second generation 800 MHz G4 iMac just doesn't have the graphics or processing capacity to cope with the SL system requirements. In one sense I'm relieved because I don't have time to screw around on SL. But I really do want to see what's happening in there because I think SL is on the leading edge of some very exciting things that are just around the corner for all of us (or at least all of you that bother reading this).

It's not just the visualization or the social networking element of SL that turns me on, because all that's been done before. I do think it's kinda sexy that SL has a functioning (if fragile) economy, based on information exchange, on buying and selling non tangible objects (clothes, skins, actions, etc,) and on services (mostly sleazy, granted). Real businesses and orgs like Reuters, CNET and the US Democratic party are opening offices in SL to reach people and become actors in that economy.

And I think it's incredibly sexy that non-human actors and intelligent agents are involved in a big way. For example the SL EcoWiki project, which is designing "scripted species" that "...consist of independent, goal seeking agents whose interactions would emulate a real world ecosystem."

So with this kind of artificial life combined with autonomous intelligent agents already prowling around SL, it takes us a good step towards virtual intelligence if not true artificial intelligence. It's in the very early stages, and no telling where this is going to go or how long it's going to take. But when you can enter a virtual, evolving, self sustaining ecosystem, and can't be certain that any avatar or object you communicate with is controlled by a human or an intelligent agent (the old Turing test again), we get into some very interesting territory.

Second Life may not become the true metaverse in the Neal Stephenson sense--it's still a very fragile environment in too many ways. But the Internet we know today coalesced from lots of smaller networks that were created for different needs and grew together organically (Usenet, UUNET, ARPANET, X.25, JANET, Milnet, NSFNet, CSNet, CERNET, etc.) Why shouldn't Second Life engender and then merge with more robust, less proprietary systems in the future?

Anyway, here's a piece by Warren Ellis, who knows a lot more about all this than I do. Second Life Sketches: Two Worlds - Fame and Infamy

Momofuku Ando, Father of Instant Noodles

Momofuku Ando, the inventor of instant ramen noodle soup, has died in Japan at the age of 96. Let's all raise a glass to Momofuku-sama. If it wasn't for him, my calorie count from the ages of 18 to 25 would have dropped to a starvation level, and I'm pretty sure I'd never have had the strength to make it through college.

Starting a new year

Happy 2007 to everyone, may this year bring us all peace and kind fortune. And Happy Christmas to my Orthodox friends. Hope you're all staying warm and happy.

I have a little free time right now so I'm going spend it pumping out some articles I've had queued up for a while. Bear with me.

News? Lots of stuff going on personally. Still filling two positions at my day job, and no hope of getting any help until March at the earliest. That's been sucking up all the oxygen around here and explains why I haven't been communicative for the past few months. I'm really looking forward to being able to focus on my new job number two, and hand off a lot of the other stuff to someone else. I'd clone myself if I could. There's some potential big news coming up that I can't talk about.

Some travel in the pipe- Istanbul (for business) and Dubai (for pleasure) at the end of January. If I can get the headspace clear I want to set up some interviews before I go. Dubai is a fascinating place- it is arguably the most important commercial hub in the Gulf States, but it has almost no oil reserves. So the explosive growth of its economy is based completely on finance, tourism, and its location as a travel hub between Europe and Asia. Money flocks to it because the rulers decided years ago on a policy of modernism, internationalism and cultural tolerance. This is in contrast to its less tolerant Gulf State neighbors and especially the regional giants of Iran and Saudi Arabia.

But while it's great that the leadership of Dubai has chosen tolerance and modernism as a method of grabbing prosperity, I don't agree with people who claim that Dubai is on the leading edge of a wave of reformism that will sweep across the Middle East. I think it's policies reflect economic pragmatism more than reformism, and I don't think the leadership even wants any cultural spillover effect into the rest of the region. Dubai is surrounded by some very big neighbors, and beyond the geopolitics, the Emirate is in the middle of a region that has been breeding millions of unemployed and very angry individuals, a small number of whom, shall we say, tend towards unpredictable behavior.

So besides lounging around on the beach in the sun (without a gin martini or bottle of Corona, alas), I want to see how that tension between economic pragmatism, the reformist impulse, and poltical & religious realism expresses itself in the country. Also, Sheikh Maktoum III bin Rashid Al Maktoum, hereditary Prime Minister of Dubai, passed away just a year ago. The new PM, Sheikh Mohammed bin Rashid Al Maktoum (referred to fondly as "Big Mo" by Western expatriates) is following the modernist-commercialist policies of his predecessors, but I want to find out how foreign investors feel about putting billions of dollars into a country where the next hereditary (and unelected) leader has the power to make drastic changes in government policy at a whim.

And finally, there's the unpleasantness with the Americans happening just a few hundred kilometers north. And just across the Hormuz, a rising Iran. How does it feel to buy real estate in that neighborhood?